Top » Catalog » SNPs » S2122

$18.00

S2122
[S2122]

S2122
hg38 Position: ChrY:14144217..14144217
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1b (not listed)
Comments: Below Z73
Forward Primer: S2122_F AGAATAAGACAAATCTGGGTGAGG
Reverse Primer: S2122_R CAATACTCCTTTTCCCTTAAAAGGAC
Reviews

Customers who bought this product also purchased
I1-Z2539 (including L1302) Panel
I1-Z2539 (including L1302) Panel
BY479
BY479
I1 Superclade Panel
I1 Superclade Panel
Z62
Z62
Z2900
Z2900
Z2539
Z2539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies