Top » Catalog » SNPs » FGC15914

$18.00

FGC15914
[FGC15914]

FGC15914
hg38 Position: ChrY:20443527..20443527
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC15914_F TTGAAGAAGACACAAATGACTAAAAAG
Reverse Primer: FGC15914_R GTTCAAAAAGACCATACATTCTGC
Reviews

Customers who bought this product also purchased
L558
L558
Z2222
Z2222
PH1038
PH1038
Y36618
Y36618
J2-M172 Superclade Panel
J2-M172 Superclade Panel
M67
M67
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies