Top » Catalog » SNPs » M205

$18.00

M205
[M205]

M205
hg38 Position: ChrY:13475629..13475629
Ancestral: T
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2b1
Comments: UTYIntron2a
Forward Primer: M205_F TGGGATCATTCGTTAGCATC
Reverse Primer: M205_R ACAGGTATCCACCACCATGC
Reviews

Customers who bought this product also purchased
Y-GATA-H4
Y-GATA-H4
YSEQ-Alpha
YSEQ-Alpha
A28980
A28980
BY22554
BY22554
BY22530
BY22530
Y167717
Y167717
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies