Top » Catalog » SNPs » M205

$18.00

M205
[M205]

M205
hg38 Position: ChrY:13475629..13475629
Ancestral: T
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2b1
Comments: UTYIntron2a
Forward Primer: M205_F TGGGATCATTCGTTAGCATC
Reverse Primer: M205_R ACAGGTATCCACCACCATGC
Reviews

Customers who bought this product also purchased
M267
M267
Y22521
Y22521
Y134178
Y134178
Y140993
Y140993
Y47134
Y47134
FT57341
FT57341
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies