Top » Catalog » SNPs » CTS6

$18.00

CTS6
[CTS6]

CTS6
hg38 Position: ChrY:2789308..2789308
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a1a1b2a2b1a
Comments: Syn. with CTS3412; downstream Z94; under Z2122
Forward Primer: CTS6_F GACACAAGGCACCACATAGG
Reverse Primer: CTS6_R CTCTCAAAACAGCCGGTCAC
Reviews

Customers who bought this product also purchased
YP1451
YP1451
Z2124
Z2124
FGC18226
FGC18226
M458
M458
Z2123
Z2123
Y2619
Y2619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies