Top » Catalog » SNPs » PH4306

$18.00

PH4306
[PH4306]

PH4306
hg38 Position: ChrY:17068950..17068950
Ancestral: T
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: PH4306_F GGAACAGGAGTGTCAAACAGG
Reverse Primer: PH4306_R TTACCTGGATGGTCAATGAAG
Reviews

Customers who bought this product also purchased
Y22521
Y22521
Y134178
Y134178
Y140993
Y140993
Y47134
Y47134
FT57341
FT57341
Y24809
Y24809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies