Top » Catalog » SNPs » F1345

$18.00

F1345
[F1345]

F1345
hg38 Position: ChrY:8737635..8737635
Ancestral: C
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: R1a1a1b2a2b1
Comments: Found in a hg R1a person. Likely a singleton.
Forward Primer: F1345_F AAATGCTGAATATTAGTGCTGTCAAG
Reverse Primer: F1345_R GTTTTCCAGTTCACGGAGAATATC
Reviews

Customers who bought this product also purchased
FGC57579
FGC57579
Y2569
Y2569
Y879
Y879
FT369423
FT369423
Y878
Y878
FT67857
FT67857
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies