Top » Catalog » SNPs » Z34460

$18.00

Z34460
[Z34460]

Z34460
hg38 Position: ChrY:19792975..19792975
Ancestral: G
Derived: A
Reference: Chris Rottensteiner (2015)
ISOGG Haplogroup: J2-Z7308(xZ6088)
Comments: Z7308/S9775(xZ6088)
Forward Primer: Z34460_F TAGAATGATTTATAATCCTTTGGGTATATG
Reverse Primer: Z34460_R ACATCCAGAATCTACAAATAACTTAGACAG
Reviews

Customers who bought this product also purchased
Z7290
Z7290
PF5172
PF5172
Z7366
Z7366
J2a-PF5197 Panel
J2a-PF5197 Panel
PF5177
PF5177
S19231
S19231
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies