Top » Catalog » SNPs » Z34460

$18.00

Z34460
[Z34460]

Z34460
hg38 Position: ChrY:19792975..19792975
Ancestral: G
Derived: A
Reference: Chris Rottensteiner (2015)
ISOGG Haplogroup: J2-Z7308(xZ6088)
Comments: Z7308/S9775(xZ6088)
Forward Primer: Z34460_F TAGAATGATTTATAATCCTTTGGGTATATG
Reverse Primer: Z34460_R ACATCCAGAATCTACAAATAACTTAGACAG
Reviews

Customers who bought this product also purchased
S19231
S19231
L1064
L1064
PF5174
PF5174
Z7290
Z7290
PF5172
PF5172
Z7366
Z7366
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies