Top » Catalog » SNPs » PF5183

$18.00

PF5183
[PF5183]

PF5183
hg38 Position: ChrY:13604443..13604443
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5183_F GCTGGCAACTGATTGTATGG
Reverse Primer: PF5183_R TTGCAAGGATCTGCACTAGC
Reviews

Customers who bought this product also purchased
M67
M67
PF5174
PF5174
L26
L26
PF5172
PF5172
J2-M172 Superclade Panel
J2-M172 Superclade Panel
J2a-PF5197 Panel
J2a-PF5197 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies