Top » Catalog » SNPs » PF5183

$18.00

PF5183
[PF5183]

PF5183
hg38 Position: ChrY:13604443..13604443
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF5183_F GCTGGCAACTGATTGTATGG
Reverse Primer: PF5183_R TTGCAAGGATCTGCACTAGC
Reviews

Customers who bought this product also purchased
PF7421
PF7421
Z7290
Z7290
PF5197
PF5197
PF5177
PF5177
L24
L24
S19231
S19231
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies