Top » Catalog » SNPs » A9355

$18.00

A9355
[A9355]

A9355
HG19 Position: ChrY:7399655..7399655
Ancestral: C
Derived: T
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of S744
Forward Primer: A9355_F GAAACATGTACCCAGGGAGAAC
Reverse Primer: A9355_R CAACACCTCCACTTGGGG
Reviews

Customers who bought this product also purchased
S744
S744
Y15478
Y15478
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
CTS4931
CTS4931
PF5236
PF5236
Y17075
Y17075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies