Top » Catalog » SNPs » A9355

$18.00

A9355
[A9355]

A9355
hg38 Position: ChrY:7531614..7531614
Ancestral: C
Derived: T
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of S744
Forward Primer: A9355_F GAAACATGTACCCAGGGAGAAC
Reverse Primer: A9355_R CAACACCTCCACTTGGGG
Reviews

Customers who bought this product also purchased
CTS4931
CTS4931
PF5236
PF5236
Y17075
Y17075
A1141
A1141
S691
S691
S6198
S6198
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies