Top » Catalog » SNPs » Y7829

$18.00

Y7829
[Y7829]

Y7829
hg38 Position: ChrY:8566603..8566603
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: I2-Y7153
Comments: Below CTS1977> Y4946 > Y7153. Aka FGC29319.
Forward Primer: Y7829_F CAGGCTTGGCTTGATTTTTC
Reverse Primer: Y7829_R CATCTGCAAGAGGCTGTGTG
Reviews

Customers who bought this product also purchased
A11207
A11207
A11212
A11212
Y7828
Y7828
A11211
A11211
Y7825
Y7825
A11210
A11210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies