Top » Catalog » SNPs » A9358

$19.00

A9358
[A9358]

A9358
hg38 Position: ChrY:13296939..13296939
Ancestral: G
Derived: T
Reference: Richard Cameron (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream S691 > S695 > S701
Forward Primer: A9358_F AGCATTTTGGCGAGAAACAG
Reverse Primer: A9358_R CTGGCACCTCTCTTTGCTTC
Reviews

Customers who bought this product also purchased
S690
S690
S764
S764
S701
S701
S744
S744
A850
A850
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies