Top » Catalog » SNPs » CTS1969

$19.00

CTS1969
[CTS1969]

CTS1969
hg38 Position: ChrY:12015457..12015457
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of M205
Forward Primer: CTS1969_F TTCCTGGCCACTTTGCTTAC
Reverse Primer: CTS1969_R ATCTCACTGGGGCTTGTCTG
Reviews

Customers who bought this product also purchased
WGS
WGS
Y47091
Y47091
FT72523
FT72523
Y85171
Y85171
FT251253
FT251253
Y46973
Y46973
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies