Top » Catalog » SNPs » Y14678

$18.00

Y14678
[Y14678]

Y14678
hg38 Position: ChrY:14092596..14092596
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y14678_F CTCAAGAGGTACTCCTAACGTATCG
Reverse Primer: Y14678_R CCTAAAGAAAAGTAACTGCCAGTCC
Reviews

Customers who bought this product also purchased
CTS7683
CTS7683
Y84796
Y84796
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y176993
Y176993
M172
M172
Y8531
Y8531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies