Top » Catalog » SNPs » Y14678

$18.00

Y14678
[Y14678]

Y14678
hg38 Position: ChrY:14092596..14092596
Ancestral: A
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y14678_F CTCAAGAGGTACTCCTAACGTATCG
Reverse Primer: Y14678_R CCTAAAGAAAAGTAACTGCCAGTCC
Reviews

Customers who bought this product also purchased
PF5088
PF5088
Y29011
Y29011
M96
M96
Z6049
Z6049
FGC56202
FGC56202
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies