Top » Catalog » SNPs » A6238

$18.00

A6238
[A6238]

A6238
hg38 Position: ChrY:19605767..19605767
Ancestral: C
Derived: G
Reference: William Hartley (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Downstream Z60
Forward Primer: A6238_F CATGCCCAGTATCTGCAATG
Reverse Primer: A6238_R TGCAACAGACAAGAATTGAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies