Top » Catalog » SNPs » Y2630

$18.00

Y2630
[Y2630]

Y2630
hg38 Position: ChrY:15100818..15100818
Ancestral: A
Derived: T
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b2 (not listed)
Comments: Found from public sources aka. S4574
Forward Primer: Y2630_F GACTTCATCAAGGTGATTCATTG
Reverse Primer: Y2630_R CCCTTATCCCAGTCCACATC
Reviews

Customers who bought this product also purchased
Y2395
Y2395
CTS6
CTS6
M458
M458
Z2125
Z2125
YP5480
YP5480
R1a Superclade Panel
R1a Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies