Top » Catalog » SNPs » A9400

$18.00

A9400
[A9400]

A9400
hg38 Position: ChrY:2943503..2943503
Ancestral: G
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of A8380
Forward Primer: A9400_F TGGCACTAATCAGGTTGCTG
Reverse Primer: A9400_R ACTGAACCAAGGGCCAATC
Reviews

Customers who bought this product also purchased
FGC41937
FGC41937
A8380
A8380
DYS635
DYS635
DYS460
DYS460
DYS447
DYS447
FGC41951
FGC41951
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies