Top » Catalog » SNPs » FGC41940

$18.00

FGC41940
[FGC41940]

FGC41940
hg38 Position: ChrY:20038380..20038380
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of A8380
Forward Primer: FGC41940_F TAAATTCCTGGGCCCACATAC
Reverse Primer: FGC41940_R TGCATCCCAAGGATACAGC
Reviews

Customers who bought this product also purchased
DYS447
DYS447
A8380
A8380
DYS635
DYS635
DYS460
DYS460
FGC41937
FGC41937
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies