Top » Catalog » SNPs » FGC41952

$18.00

FGC41952
[FGC41952]

FGC41952
hg38 Position: ChrY:8887999..8887999
Ancestral: G
Derived: A
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of A8380
Forward Primer: FGC41952_F TGTATGAATAATGCTACAGATGAATGAC
Reverse Primer: FGC41952_R CATTGAGTAAAAACCCAAGGTCAC
Reviews

Customers who bought this product also purchased
DYS460
DYS460
DYS447
DYS447
FGC41937
FGC41937
A8380
A8380
DYS635
DYS635
FGC41951
FGC41951
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies