Top » Catalog » SNPs » A541

$18.00

A541
[A541]

A541
hg38 Position: ChrY:8938429..8938429
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a
Comments: Below CTS4466 and above S1121 & A195
Forward Primer: A541_F ACTCTCTGTGCCTCCTCCAC
Reverse Primer: A541_R GGAGTCTTTGGTGGTGTTGC
Reviews

Customers who bought this product also purchased
L21
L21
A10641
A10641
A159
A159
A9005
A9005
A923
A923
A6508
A6508
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies