Top » Catalog » SNPs » FGC5325

$18.00

FGC5325
[FGC5325]

FGC5325
hg38 Position: ChrY:7522238..7522238
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC5325_F AGTGCTGTCCCCATAATAGTGAG
Reverse Primer: FGC5325_R CAAGGCCACAGGAAAGAGAC
Reviews

Customers who bought this product also purchased
YFS4293977
YFS4293977
FGC68210
FGC68210
YFS4293944
YFS4293944
DYS463
DYS463
YFS4293920
YFS4293920
YSEQ-Gamma
YSEQ-Gamma
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies