Top » Catalog » SNPs » A542

$18.00

A542
[A542]

A542
hg38 Position: ChrY:19610738..19610738
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b1a1
Comments: Below S1121
Forward Primer: A542_F ACTCCTGTAATCAAGTGACACTCCT
Reverse Primer: A542_R AGGCTCCTCTGGGGACTG
Reviews

Customers who bought this product also purchased
A6508
A6508
A9005
A9005
A195
A195
S1115
S1115
A808
A808
A804
A804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies