Top » Catalog » SNPs » Z16385

$18.00

Z16385
[Z16385]

Z16385
hg38 Position: ChrY:14919660..14919660
Ancestral: T
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2c
Comments: downstream of L513
Forward Primer: Z16385_F CATCTTGTTACACCCTGTGATATG
Reverse Primer: Z16385_R ACTTGTGCATTGCATTAGTCAAG
Reviews

Customers who bought this product also purchased
Z17807
Z17807
FGC11791
FGC11791
BY359
BY359
L1333
L1333
BY2598
BY2598
Z17816
Z17816
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies