Top » Catalog » SNPs » A9429

$18.00

A9429
[A9429]

A9429
hg38 Position: ChrY:14990062..14990062
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4466 > A541
Forward Primer: A9429_F TCAGGAGTCCCAAGATCAGC
Reverse Primer: A9429_R GTTGGGTATCCAAGGAAAAAGG
Reviews

Customers who bought this product also purchased
A11222
A11222
A541
A541
A11218
A11218
A9426
A9426
A9450
A9450
A9425
A9425
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies