Top » Catalog » SNPs » A9428

$18.00

A9428
[A9428]

A9428
hg38 Position: ChrY:12983800..12983800
Ancestral: T
Derived: C
Reference: Ed Aber Leek (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4466 > A541
Forward Primer: A9428v2_F AGAAATTCACTGTTAGTCTAATAATGACC
Reverse Primer: A9428v2_R AAAAATTCTCAGAATTCGAAGAGAGC
Reviews

Customers who bought this product also purchased
A11222
A11222
A11218
A11218
A541
A541
R1b-A541 Aber Panel
R1b-A541 Aber Panel
A9429
A9429
A9427
A9427
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies