Top » Catalog » SNPs » A9428

$18.00

A9428
[A9428]

A9428
hg38 Position: ChrY:12983800..12983800
Ancestral: T
Derived: C
Reference: Ed Aber Leek (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4466 > A541
Forward Primer: A9428v2_F AGAAATTCACTGTTAGTCTAATAATGACC
Reverse Primer: A9428v2_R AAAAATTCTCAGAATTCGAAGAGAGC
Reviews

Customers who bought this product also purchased
A11222
A11222
A11218
A11218
A541
A541
A9425
A9425
A9432
A9432
A9424
A9424
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies