Top » Catalog » SNPs » A9450

$18.00

A9450
[A9450]

A9450
hg38 Position: ChrY:13032273..13032273
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4466_A541
Forward Primer: A9450_F AAACCTCAGCAAACACCAGAC
Reverse Primer: A9450_R TCTGGCATTCCTGGTTTCTC
Reviews

Customers who bought this product also purchased
A11222
A11222
A11218
A11218
A541
A541
R1b-A541 Aber Panel
R1b-A541 Aber Panel
A9428
A9428
A9427
A9427
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies