Top » Catalog » SNPs » Z16361

$18.00

Z16361
[Z16361]

Z16361
hg38 Position: ChrY:18966384..18966384
Ancestral: A
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2b
Comments: downstream of L513. Warning: SNP is in the middle of a poly T homopolymer!
Forward Primer: Z16361_F TGCCTGTAATCCGTTACTTGG
Reverse Primer: Z16361_R AATGAACATCACAGCACCTG
Reviews

Customers who bought this product also purchased
FGC11791
FGC11791
BY359
BY359
L1333
L1333
Z17807
Z17807
Z39589
Z39589
FGC13422
FGC13422
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies