Top » Catalog » SNPs » Z39589

$18.00

Z39589
[Z39589]

Z39589
hg38 Position: ChrY:4571871..4571888
Ancestral: ins
Derived: del
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13
Forward Primer: Z39589v2_F GCTGTAACACTGACTGCAAAGC
Reverse Primer: Z39589v2_R ACAGTTCTTAAAGATGGTGTGTCG
Reviews (1)

Customers who bought this product also purchased
S5668
S5668
A874
A874
Y5641
Y5641
A40
A40
Z18021
Z18021
BY23955
BY23955
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies