Top » Catalog » SNPs » Z39589

$18.00

Z39589
[Z39589]

Z39589
hg38 Position: ChrY:4571871..4571888
Ancestral: ins
Derived: del
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13
Forward Primer: Z39589v2_F GCTGTAACACTGACTGCAAAGC
Reverse Primer: Z39589v2_R ACAGTTCTTAAAGATGGTGTGTCG
Reviews (1)

Customers who bought this product also purchased
BY20329
BY20329
A1149
A1149
A7763
A7763
A7759
A7759
BY7804
BY7804
A88
A88
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies