Top » Catalog » SNPs » Z39589

$18.00

Z39589
[Z39589]

Z39589
hg38 Position: ChrY:4571871..4571888
Ancestral: ins
Derived: del
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13
Forward Primer: Z39589v2_F GCTGTAACACTGACTGCAAAGC
Reverse Primer: Z39589v2_R ACAGTTCTTAAAGATGGTGTGTCG
Reviews (1)

Customers who bought this product also purchased
BY13680
BY13680
A5388
A5388
FGC10138
FGC10138
FGC64966
FGC64966
S603
S603
S7050
S7050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies