Top » Catalog » SNPs » Z39589

$18.00

Z39589
[Z39589]

Z39589
hg38 Position: ChrY:4571871..4571888
Ancestral: ins
Derived: del
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13
Forward Primer: Z39589v2_F GCTGTAACACTGACTGCAAAGC
Reverse Primer: Z39589v2_R ACAGTTCTTAAAGATGGTGTGTCG
Reviews (1)

Customers who bought this product also purchased
Y2890
Y2890
CTS5396
CTS5396
BY145208
BY145208
Y3550
Y3550
BY9005
BY9005
FT123856
FT123856
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies