Top » Catalog » SNPs » Z39589

$18.00

Z39589
[Z39589]

Z39589
hg38 Position: ChrY:4571871..4571888
Ancestral: ins
Derived: del
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13
Forward Primer: Z39589v2_F GCTGTAACACTGACTGCAAAGC
Reverse Primer: Z39589v2_R ACAGTTCTTAAAGATGGTGTGTCG
Reviews (1)

Customers who bought this product also purchased
A7298
A7298
BY248
BY248
BY39002
BY39002
BY31279
BY31279
A7299
A7299
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies