Top » Catalog » SNPs » A544

$18.00

A544
[A544]

A544
hg38 Position: ChrY:12048125..12048125
Ancestral: C
Derived: A
Reference: J. Melia (2014)
ISOGG Haplogroup: I2a1b2a
Comments: L161 subclade Isles C
Forward Primer: A544_F TCAGCATTCTGTGTGCAATTAAC
Reverse Primer: A544_R ATAGCCACAAACCCTCTTGG
Reviews

Customers who bought this product also purchased
P37.2
P37.2
I2 Superclade Panel
I2 Superclade Panel
BY92499
BY92499
BY128554
BY128554
A22306
A22306
A10514
A10514
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies