Top » Catalog » SNPs » FGC9673

$18.00

FGC9673
[FGC9673]

FGC9673
hg38 Position: ChrY:7469160..7469160
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9673_F GACCATCCAAAAACTGAATTCAC
Reverse Primer: FGC9673_R CAGCATGGGCAACAAGAGA
Reviews

Customers who bought this product also purchased
R1b-S1051 McCeney Panel
R1b-S1051 McCeney Panel
S11111
S11111
FGC9682
FGC9682
FGC9691
FGC9691
FGC9708
FGC9708
FGC9678
FGC9678
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies