Top » Catalog » SNPs » FGC9679

$18.00

FGC9679
[FGC9679]

FGC9679
hg38 Position: ChrY:10009767..10009767
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9679_F CCCACATTAAATGCAACCAG
Reverse Primer: FGC9679_R TGGCTGTCTGCAACTTCCA
Reviews

Customers who bought this product also purchased
FGC9678
FGC9678
FGC9686
FGC9686
FGC9705
FGC9705
FGC9676
FGC9676
FGC9685
FGC9685
FGC9702
FGC9702
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies