Top » Catalog » SNPs » Y14197

$18.00

Y14197
[Y14197]

Y14197
hg38 Position: ChrY:2832576..2832576
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Bute line of Stewarts. Below DF13 > DF41 > S775 > L746
Forward Primer: Y14197_F GCTCACAGATGCATATTGATAAAAC
Reverse Primer: Y14197_R CCTTCCCAAGTCTTTAAAGCC
Reviews (1)

Customers who bought this product also purchased
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
L746
L746
A40
A40
Y14198
Y14198
S775
S775
A749
A749
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies