Top » Catalog » SNPs » A9515

$18.00

A9515
[A9515]

A9515
hg38 Position: ChrY:13408975..13408975
Ancestral: T
Derived: A
Reference: Charles Acree (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z16943 > ZP110
Forward Primer: A9515_F AATGTTGAAAACATCCCAAAAC
Reverse Primer: A9515_R TGCTTACCATTTGAGATACCTGTG
Reviews

Customers who bought this product also purchased
A9516
A9516
A9520
A9520
A9519
A9519
A9518
A9518
A9517
A9517
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies