Top » Catalog » SNPs » A9518

$18.00

A9518
[A9518]

A9518
hg38 Position: ChrY:19120251..19120251
Ancestral: G
Derived: A
Reference: Charles Acree (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z16943 > ZP110
Forward Primer: A9518_F TCAAATACTCTGCTAGCTATGATTGAG
Reverse Primer: A9518_R AACCATTCCTGATGATGGC
Reviews

Customers who bought this product also purchased
A9517
A9517
A9516
A9516
A9515
A9515
A9520
A9520
A9519
A9519
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies