Top » Catalog » SNPs » FTA60432

$19.00

FTA60432
[FTA60432]

FTA60432
hg38 Position: ChrY:13078430..13078430
Ancestral: C
Derived: T
Reference: FTDNA (2021)
ISOGG Haplogroup: J2b
Comments: Below L283 > Z38241
Forward Primer: FTA60432_F CTCCCTGGTTCAAGGGG
Reverse Primer: FTA60432_R TGATACATATTTCAAAGTGTGTCAACC
Reviews

Customers who bought this product also purchased
J2b-M12 Panel
J2b-M12 Panel
FT202033
FT202033
L283
L283
M9
M9
Z34474
Z34474
M12
M12
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies