Top » Catalog » SNPs » FGC9692

$18.00

FGC9692
[FGC9692]

FGC9692
hg38 Position: ChrY:14818988..14818988
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9692_F CAGTGTGCTTTCCAGTGATGA
Reverse Primer: FGC9692_R CCTTCCTTGAGCAGCTACAAG
Reviews

Customers who bought this product also purchased
FGC9676
FGC9676
FGC9685
FGC9685
FGC9702
FGC9702
FGC9672
FGC9672
FGC9684
FGC9684
FGC9700
FGC9700
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies