Top » Catalog » SNPs » FGC9704

$18.00

FGC9704
[FGC9704]

FGC9704
hg38 Position: ChrY:19601892..19601892
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9704_F TCTTCCTCCCCTTATTTTTGG
Reverse Primer: FGC9704_R AAGCAGCAGTAACCAAAGCAG
Reviews

Customers who bought this product also purchased
FGC9683
FGC9683
FGC9695
FGC9695
R1b-S1051 McCeney Panel
R1b-S1051 McCeney Panel
S11111
S11111
FGC9682
FGC9682
FGC9691
FGC9691
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies