Top » Catalog » SNPs » A306

$17.50

A306
[A306]

A306
HG19 Position: ChrY:23963147..23963147
Ancestral: A
Derived: G
Reference:
ISOGG Haplogroup: R1b (not listed)
Comments:
Forward Primer: A306v2_F GGGATCTTCACTCTTGCTCG
Reverse Primer: A306v2_R GGATAATGAAAAACACACCCTTG
Reviews

Customers who bought this product also purchased
S310
S310
A5023
A5023
S775
S775
S781
S781
L746
L746
MC21
MC21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies