Top » Catalog » SNPs » A306

$18.00

A306
[A306]

A306
hg38 Position: ChrY:21817000..21817000
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A306v2_F GGGATCTTCACTCTTGCTCG
Reverse Primer: A306v2_R GGATAATGAAAAACACACCCTTG
Reviews

Customers who bought this product also purchased
A309
A309
A5023
A5023
S310
S310
MC21
MC21
BY114
BY114
A40
A40
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies