Top » Catalog » SNPs » FGC4453

$18.00

FGC4453
[FGC4453]

FGC4453
hg38 Position: ChrY:13128741..13128741
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a1a1
Comments: Below L222.2 > FGC1721
Forward Primer: FGC4453v2_F TTTTCCACATTCCCCAAATC
Reverse Primer: FGC4453v2_R GGGGTCTTCGGGAATTTAAC
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
ZS4946
ZS4946
ZS4737
ZS4737
ZS4727
ZS4727
BY68843
BY68843
BY16791
BY16791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies