Top » Catalog » SNPs » FGC4453

$18.00

FGC4453
[FGC4453]

FGC4453
hg38 Position: ChrY:13128741..13128741
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a1a1
Comments: Below L222.2 > FGC1721
Forward Primer: FGC4453v2_F TTTTCCACATTCCCCAAATC
Reverse Primer: FGC4453v2_R GGGGTCTTCGGGAATTTAAC
Reviews

Customers who bought this product also purchased
FGC29838
FGC29838
FGC10592
FGC10592
FGC10599
FGC10599
A10526
A10526
BY9586
BY9586
FGC4465
FGC4465
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies