Top » Catalog » SNPs » FGC23071

$18.00

FGC23071
[FGC23071]

FGC23071
hg38 Position: ChrY:8838146..8838146
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: FGC23071_F TCACATACCACCATGCTCAATAAC
Reverse Primer: FGC23071_R TGTTAACAAGCCAAAGGAGGAG
Reviews

Customers who bought this product also purchased
FGC40704
FGC40704
BY27833
BY27833
Y138237
Y138237
L238
L238
BY96801
BY96801
FGC20761
FGC20761
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies