Top » Catalog » SNPs » MZ99

$18.00

MZ99
[MZ99]

MZ99
hg38 Position: ChrY:8755566..8755566
Ancestral: C
Derived: T
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1 (not listed)
Comments: Downstream of A929
Forward Primer: MZ99v2_F TGTTCTGAGGCTAGCTCATGG
Reverse Primer: MZ99v2_R AAACTGCAAAATCCCTAAAGATACC
Reviews

Customers who bought this product also purchased
MZ146
MZ146
Z5011
Z5011
MZ39
MZ39
BY9671
BY9671
MZ151
MZ151
Z21074
Z21074
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies