Top » Catalog » SNPs » MZ99

$18.00

MZ99
[MZ99]

MZ99
hg38 Position: ChrY:8755566..8755566
Ancestral: C
Derived: T
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1 (not listed)
Comments: Downstream of A929
Forward Primer: MZ99v2_F TGTTCTGAGGCTAGCTCATGG
Reverse Primer: MZ99v2_R AAACTGCAAAATCCCTAAAGATACC
Reviews

Customers who bought this product also purchased
Y88783
Y88783
Y225721
Y225721
M165
M165
MF4289
MF4289
M5343
M5343
Y109169
Y109169
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies